FAŁSZYWA MATRYCA WNIEBOWSTĄPIENIA 5D

False 5D Ascension Matrix to nieorganiczna technologia obcych, która została zainstalowana na płaszczyźnie astralnej (4D) i jest kontrolowana głównie w wyższym wymiarze pola dźwiękowego osi czasu 5D. Jest to prąd fałszywego białego światła (znany również jako światło Świadomości Fałszywego Chrystusa), który pozyskuje i manipuluje z niższych wymiarów, wymiarowych Matriksa Duszy poprzez „kościelnego religijnego Jezusa”, który z religią nigdy tak naprawdę nie miał nic wspólnego, a wręcz przeciwnie – przyszedł min. obalić ten podstępny system religijny. Rzymski KATolicyzm to podstępna pułapka dla dusz. Watykan, to stolica samego szatana o której czesto mówił Jezus.

To Fałszywe „Białe Światło”, tworzy skomplikowaną sieć z wieloma Obcymi Implantami i bioneurologiczną technologią Kontroli Umysłu, która jest wywierana na ludzkie ciało i umysł poprzez manipulację falami o niższej częstotliwości. Dzięki tej większej sieci na płaszczyźnie astralnej możliwe jest użycie wstawek holograficznych i instalowanie programów, które kontrolują umysł ludzi do generowania i promowania systemów przekonań opartych na strachu. Jest to część tłumienia przez Świadomość ludzkości w tym cyklu wznoszenia, która zmusza reinkarnację do niższych sfer pól czasu na Ziemi.

Gospodarze Szmaragdowych i Kryształowych Strażników ujawnili Obcą Maszynę i Sieci, które są używane do Wymazywania Świadomości WSZYSTKICH mieszkańców planety, zwracając uwagę na fałszywe światło używane w Fałszywej Matrycy Wniebowstąpienia 5D, a także powtarzające się recykling dusz, które są kierowane w Pułapki Świadomości i pozaplanetarne schematy upadłych aniołów, które czynią Ziemię Więzienną Planetą. Podczas cyklu wznoszenia, Strażnicy Kryształowej Gwiazdy są zasadniczo na misji ratunkowej, aby pomóc planecie wznieść się i wyzwolić dusze na Ziemi spod kontroli umysłu.

JAK USUWA SIĘ PAMIĘĆ DUSZY

Szeroki obszar kosmosu jest monitorowany przez „elektroniczne pole siłowe”, które kontroluje wszystkie dusze na tym końcu galaktyki, w tym Ziemię. Elektroniczny ekran siłowy ma na celu wykrywanie dusz w momencie śmierci cielesnej i uniemożliwianie im opuszczenia obszaru. Jeśli jakakolwiek dusza próbuje przebić się przez ekran siłowy, „chwyta” ją w rodzaj „elektronicznej sieci”. W rezultacie schwytana Dusza jest poddawana bardzo surowemu zabiegowi „prania mózgu”, który wymazuje pamięć Dusz z poprzedniego życia. Ten proces wykorzystuje ogromny wstrząs elektryczny. Napięcie elektryczne użyte przez operację uwięzienia Anunnaki przeciwko Duszom Tary jest rzędu miliardów woltów! Ten ogromny szok całkowicie wymazuje całą pamięć Duszy, nie tylko na jedno życie, Wymazuje wszystkie nagromadzone doświadczenia z prawie nieskończonej przeszłości, a także tożsamość Duszy!

Gdy dusza odcieleśnia się, zostaje wykryta przez „ekran siły”, przechwycony i „rozkazany” przez hipnotyczny rozkaz „powrotu do światła”. Idea „nieba” i „życia pozagrobowego” są częścią sugestii hipnotycznej – częścią zdrady, która sprawia, że ​​cały mechanizm działa. Po tym, jak Dusza została zszokowana i zahipnotyzowana, aby wymazać pamięć o życiu, które właśnie przeżyła, natychmiast zostaje „polecona”, hipnotycznie, „zgłosić się” z powrotem na Ziemię, tak jakby była na tajnej misji, aby zamieszkać w nowym ciele. Każdej Duszy mówi się, że ma specjalny cel bycia na Ziemi. Ale oczywiście nie ma sensu przebywać w więzieniu – przynajmniej nie dla więźnia. Obejmuje to polecenie „powrotu” do bazy po śmierci ciała, aby ten sam rodzaj szoku i hipnozy mógł być powtarzany i powtarzany – na zawsze.

Ferdie Fallar Fronds

PUŁAPKA DLA DUSZ: https://youtu.be/fkXrV2MCCgY

PRZEJĘCIE LUDZKICH DUSZ: https://youtu.be/zdOveVZwV6g

MANIPULACJA SZTUCZNEJ INTELIGENCJI: https://youtu.be/O1dWwhdAhOQ

POCZEKALNIA DLA DUSZ: https://youtu.be/RfuTOuOUHWs

GDZIE IDZIE ENERGIA Z CIERPIENIA: https://youtu.be/kFHXM0GIgqg

POWRÓT DO ZRÓDŁA – prawdziwego duchowego domu: https://youtu.be/-Bf4owKQf3Q

Kopuła – firmament

Prawdziwa historia ludzkości od początku do końca jest jedynie do odtworzenia w zakodowanych wiadomościach i symbolice

Kopuła Torusa zakrywa naszą mikroskopijną maleńką część Płaskiej Ziemi!

Cała domena Płaskiej Ziemi jest zbudowana z formy życia na bazie krzemu o tytanicznych proporcjach.

Anunaki zakwaterowali się w środowisku mężczyzn i kobiet tytanów opartych na krzemie oraz gigantycznych drzew krzemowych o wysokości do 120 km.

Po wygraniu wojny z tytanami stworzyli Szarych jako ich niewolników, by ścinać gigantyczne drzewa i dbać o tereny do oczyszczania krzemu, z których mieli budować swoje kryształowe miasta.

Ostatecznie, po kilku tysiącach lat, precyzując, po 5508 latach, praca została wykonana. Ziemia o średnicy 400 000 km oczyszczone ze wszystkich gigantycznych drzew krzemowych, zbudowane ich krzemowe miasta.

Elektromagnetyczny Torus Firmament aktywował pokrycie i odseparowanie terenu o średnicy 400.000 km, więc nic nie może uciec i nikt nie może wejść z zewnątrz, z wyjątkiem samych Anunaki przez portale plazmowe Gwiezdnych Wrót.

W tym momencie ludzie, rośliny i zwierzęta nie istniały i aby zebrać dla siebie duszę, Anunaki musieli stworzyć ludzką węglową formę życia. Stworzenie ludzi pod Kopułą – Firmament tutaj na Ziemi rozpoczęło się po raz pierwszy dokładnie 2021 lat temu.

Z czego wykonana jest Kopuła?

Kopuła – Firmament to ekranowanie elektromagnetycznego torusa.

Aktywacja tego rodzaju osłony zajmuje tylko kilka godzin, do której Anunaki już posiadali technologię, zanim tu przybyli. Elektromagnetyczna tarcza plazmowa odbija promieniowanie, a także odbija się od niego każdy atak wroga z zewnątrz.

Firmament zbudowany jest z elektromagnetycznego ekranu plazmowego.

Kopuła ekranowania elektromagnetycznego torusa – Firmament obejmuje obszar o średnicy 400 000 km na ziemi i kolejne 400 000 km pod ziemią.

Powodem, dla którego Graysowi zajęło 5508 lat, aby ukończyć cały projekt, który zaprojektował Anunaki, jest to, że oprócz oczyszczenia terenu na ziemi, wykonali również wiele kopania pod ziemią, gdzie rezydują główni naukowcy odpowiedzialni za projekt, znani jako Underworld. .

Kopanie pod ziemią nie zostało wykonane w konwencjonalny sposób, jaki znamy, ale elektrycznie przez maszyny elektromagnetyczne o dużej mocy, które natychmiast zamieniają porowatą wewnętrzną skorupę Ziemi w pył, tak jak stało się to z Bliźniaczymi Wieżami 11 września w Nowym Jorku

The Underworld to prawdziwa okazja, z wysoce zaawansowanym technologicznie systemem sieciowym, który reguluje życie na powierzchni Ziemi. Dlatego słyszymy takie terminy jak: Asgard, Midgard i Underworld (lub Hel).

O ile firmament ekranujący Torus wysuwa swoją osłonę nad ziemię, tak bardzo rozciąga się pod ziemią, tak jak skorupa ziemska jest doskonałym przewodnikiem.

Asgard to kryształowe miasto, w którym mieszka najwyższy bóg Anu wraz ze swoją świtą i sługami; Midgard jest tam, gdzie jesteśmy; a Underworld jest siedzibą głównych naukowców członków rodziny Anunaki odpowiedzialnych za projekt stworzenia rodzaju ludzkiego.

W centrum płaskiej ziemi pod Kopułą – firmamentem znajduje się duży, szeroki otwór o średnicy około 200km, w którym znajduje się maszyna do ekranowania plazmowego Torus. Gigantyczna rzeka Oceanus, która wypełnia oceany wodą, również wypływa z Underworld .Powodem, dla którego igła kompasu jest skierowana tylko na północ, jest to, że to tam znajduje się namagnesowana dipolowa oś dwustronnego lejka wirowego Torusa i w tym miejscu emitowana jest najsilniejsza energia elektromagnetyczna, która tworzy obie sfery plazmy elektromagnetycznych kopuł Torusa. , osłaniając i osłaniając zarówno tereny nad ziemią, jak i pod powierzchnią Ziemi.

Odwrócenie magnetyczne to odwrócenie pola magnetycznego torusa, gdy pozycje północy magnetycznej i południa magnetycznego są zamienione (nie mylić z geograficzną północą i geograficznym południem).

Zjawisko „przesunięcia bieguna” ma miejsce, gdy spiralny lejek pola elektromagnetycznego torusa przesuwa się z jednego kierunku w drugi, z kierunku w górę do kierunku w dół. Dzieje się to mniej więcej co 10-12 lat. Biegun północny znajduje się nad powierzchnią płaskiej Ziemi, a biegun południowy znajduje się pod ziemią w podziemnym świecie. Kiedy bieguny się przesuwają, północ idzie pod ziemię, a biegun południowy nad ziemią.

Tak więc zarówno geograficzny, jak i magnetyczny biegun północny i południowy znajdują się w centrum płaskiej Ziemi, gdzie rzeka Oceanus wypływa z wejścia do Underworld. Tak zwany biegun południowy znajdujący się na Antarktydzie jest wymysłem, ponieważ nie ma tam ani bieguna południowego, ani żadnego kontynentu antarktycznego.

Wokół środka otworu bieguna północnego znajdują się 4 duże kontynenty, podzielone 4 gigantycznymi strumieniami rzeki Oceanus, gdzie woda wypływa na zewnątrz w kierunku oceanów i z powrotem do podziemnego świata w celu recyklingu, a gdy słona woda jest poddawana recyklingowi i odsalaniu w Podziemna woda jest wysyłana z powrotem do oceanów jako słodka woda pitna, która zaopatruje mieszkańców tych 4 kontynentów w świeżą wodę pitną do spożycia i nawadniania.

Te potne rzeki dostarczyły norweskiemu żeglarzowi Olafowi Jansenowi i jego ojcu wodę pitną podczas ich podróży do Wewnętrznej Ziemi, jak opisano w książce zatytułowanej: „Zadymiony bóg, czyli podróż do wnętrza Ziemi”, napisanej przez Willisa George’a Emersona w 1908, który opisuje przygody Olafa Jansena, norweskiego żeglarza, który przepłynął z ojcem przez wejście do wnętrza Ziemi na Biegunie Północnym.

Naszych 5 kontynentów otacza lodowa ściana o wysokości od 80m. do 4 km.

Po drugiej stronie lodowej ściany otaczającej nasz znany świat jest co najmniej 33 więcej kontynentów, a w porównaniu z tą niewielką częścią o średnicy zaledwie 40 000 km, którą zajmuje nasz świat, wyobraź sobie, o ile więcej jest ziemi z całkowitej liczby 400 000 km średnicy, którą pokrywa Kopuła.

Nasz świat składający się z 5 kontynentów został celowo umieszczony bliżej podziemi z wielu powodów, takich jak np. personel naukowy Anunaki nie musi podróżować daleko, aby mieć na nas oko, krótsza odległość od rzeki Oceanus, system nawadniania sztucznej Ziemi przez największe rzeki, które wypływają spod ziemi itp.

Kolejne 33 kontynenty po drugiej stronie lodowej ściany

Tak więc cała ziemia o średnicy 400 000 km jest pokryta Kopułą (Firmament), w tym nasze 5 kontynentów, które znajdują się w centrum tej ziemi pod Kopułą.

Naszych 5 kontynentów otacza lodowa ściana o wysokości od 80m. do 4 km, która blokuje dostęp do pozostałych 33 kontynentów po drugiej stronie lodowej ściany. Biegun południowy, jaki znamy, nie istnieje! To, co wiemy o „biegunie południowym”, to w rzeczywistości lodowy pierścień ścienny, blokujący dostęp na drugą stronę do tych 33 kontynentów pod Kopułą!

Za Kopułą, po drugiej stronie liczącej 400 000 km średnicy, Płaska Ziemia rozciąga się bez końca do krzemowej flory i fauny, gdzie żyją tytani o wysokości ponad 20 km.

Gorgi Shepentulevski

Przekręt został potwierdzony: PCR nie wykrywa SARS-CoV-2

Sekwencje genetyczne stosowane w PCR do wykrywania podejrzanego SARS-CoV-2 oraz do diagnozowania przypadków choroby i śmierci przypisywanej Covid-19 są obecne w dziesiątkach sekwencji samego genomu człowieka oraz w sekwencjach około stu drobnoustrojów. Obejmuje to inicjatory lub startery, najbardziej rozległe fragmenty pobrane losowo z ich rzekomego „genomu”, a nawet tak zwane „geny docelowe”, rzekomo specyficzne dla „nowego koronawirusa”. Test jest bezwartościowy i wszystkie dotychczas uzyskane „pozytywne” wyniki powinny być naukowo unieważnione i zakomunikowane osobom nim dotkniętym, a w przypadku ich śmierci – ich krewnym. Stephen Bustin, jeden z wiodących światowych ekspertów w dziedzinie PCR, mówi, że w pewnych warunkach każdy może uzyskać wynik pozytywny!Ostrzegamy Was od marca: nie możesz przeprowadzić określonych testów na wirusa bez znajomości składników wirusa, który próbujesz wykryć. A składniki nie mogą być znane bez uprzedniego wyizolowania/oczyszczenia tego wirusa. Od tego czasu nadal gromadzimy dowody, że nikt nie wyizolował SARS-CoV-2, a co ważniejsze, że nie może zostać on nigdy wyizolowany z powodów, które wyjaśniliśmy w zeszłym miesiącu (przeczytajcie raport „Can you prove that there are pathogenic viruses?” na naszej stronie internetowej -www.dsalud.com-). A w niniejszym raporcie przedstawimy nowe dane, z których wynika, że RT-PCR nie wykrywa tzw. SARS-CoV-2, jak wiadomo, ale fragmenty ludzkiego RNA i fragmenty licznych mikrobów. Wyjaśniliśmy już liczne problemy, jakie stwarza RT-PCR, uznane przez organizacje lub rządy, takie jak WHO lub CDC oraz przez prestiżowych międzynarodowych ekspertów, takich jak dr Stephen Bustin, który uważa zarówno arbitralność ustanawiania kryteriów dla wyników, jak i wybór liczby cykli za bzdury, ponieważ mogą one prowadzić do tego, że każdy test jest pozytywny. W tym raporcie zamierzamy załączyć wyniki szczególnego badania, które przeprowadziliśmy na podstawie danych opublikowanych na temat rzekomego SARS-CoV-2 i protokołów zatwierdzonych przez WHO do stosowania RT-PCR, a także danych odpowiadających reszcie „ludzkich koronawirusów”. A wnioski są niezwykle poważne: żaden z siedmiu „ludzkich koronawirusów” nie został w rzeczywistości wyizolowany, a wszystkie sekwencje starterów ich odpowiednich reakcji PCR, jak również sekwencje dużej liczby fragmentów ich domniemanych genomów, znajdują się w różnych obszarach genomu ludzkiego oraz w genomach bakterii i archai, takich jak: Shwanella marina JCM, Dialister succinatiphilus, Lactobacillus porcine, Lactobacillus manihotivorans, Leptospira sarikeiensis, Bizionia echini, Sanguibacteroides justesenil, Bacteroides massiliensis, Lacinutrix venerupis, Moraxella bovis, Leptospira saintgironsiae, Winogradskyella undariae, Acetobacterium puteale, Chryseobacterium hispanicum, Paenibacillius koleovorans, Tamiana fuccidanivorans, Fontibacillua panacisegetis, Ru bacter ruber , Skemania piniformis, Chryseobacterium shigense, Caloramator peoteoclasticus, Cellulosilyticum ruminicola, Nitrosopumilius evryensis i długa lista innych.Wyjaśnimy krok po kroku badania, które doprowadziły nas do tak niezwykłego wniosku.

CZY JAKIEKOLWIEK LUDZKIE KORONAWIRUSY ZOSTAŁY WYIZOLOWANE?

W pierwszej połowie kwietnia, kiedy pierwsze badania, które przeprowadziliśmy wykazały, że SARS-CoV-2 nie został wyizolowany i ponieważ ci, którzy twierdzili, że to zrobili, polegali na „izolatach” poprzednich „ludzkich koronawirusów”, zaczęliśmy robić dokładny przegląd tych zgłoszonych izolatów. W szczególności dokonaliśmy przeglądu domniemanej pracy izolacyjnej podejrzanych o występowanie ludzkich koronawirusów 229E (rzekomo izolowanych w 1965 roku), OC43 (w 1967 roku), SARS-CoV (w 2003 roku), NL63 (w 2004 roku), HKU1 (w 2005 roku) i MERSCoV (w 2012 roku). I takie są wyniki: Coronavirus 229E.

Artykuł źródłowy: Dorothy Hamre i John Procknow. A new virus isolated from the human respiratory Tract. Proceedings of the Society for Experimental Biology and Medicine, 121: 1:190-193. January 1, 1966.

Ponieważ autorzy odwołują się do innych artykułów wyjaśniających metodę izolacji – którą nazywają Complement Fixation – skonsultowaliśmy się z referencyjnym artykułem na temat tej metody: artykuł Janet W. Hartley i wsp. Complement Fixation and tissue culture assay for mouse leukaemia viruses PNAS, 53(5):931-938, maj 1965. Jest to procedura już nieużywana, która wykorzystuje reakcję antygen-przeciwciało do wykrywania jednego lub drugiego. W przypadku, z którym mamy do czynienia, celem było wykrycie antygenów rzekomo nowego wirusa, ale, jak już wyjaśniliśmy, potrzebne są specyficzne przeciwciała, których nie można uzyskać przy pierwszym wykryciu wirusa. Koronawirus OC43.

Artykuł źródłowy: Paul Lee. Molecular epidemiology of human coronavirus OC43 in Hong Kong. Thesis for the Department of Microbiology, University of Hong Kong, August 2007. The HKU Scholars Hub.

To, co zostało uznane za wirusowe RNA, zostało wyekstrahowane z kultur bez żadnych dowodów na to, że RNA należy do wirusa. Użyte narzędzie – zestaw QIAamp – usuwa odczynniki, inhibitory i zanieczyszczenia, ale nie może określić, skąd pochodzi ekstrahowany RNA. I nie ma żadnej kontroli. Jest ono następnie wzmacniane przez PCR i sekwencjonowane przy założeniu (!), że jest to informacja genetyczna wirusa. Wreszcie, autor spekuluje na temat mutacji, rekombinacji, genotypów, ewolucji molekularnej, szczepów i innego żargonu, który przekazuje nieudowodnioną ideę, że „wirus” jest przedmiotem pracy. Koronawirus SARS-CoV.Artykuł źródłowy: J. S. M. Peiris and others. Coronavirus as a possible cause of SARS. Lancet 361: 1319-25, April 2003.W artykule nie ma wzmianki o oczyszczeniu. Nie ma nawet wzmianki o filtracji lub wirowaniu. Stwierdzono jedynie, że „wirusy zostały wyizolowane w komórkach wątroby płodu małpy z aspiratów z jamy nosowo-gardłowej i biopsji płuc dwóch pacjentów”. Nie ma żadnych kontroli. Jedyna wzmianka dotyczy „efektu cytopatycznego” przypisywanego wirusowi i że dla znanych wirusów i retrowirusów przeprowadzono PCR bez uzyskania wyników. Wreszcie, RT-PCR przeprowadzono z „przypadkowymi starterami” i wykryto sekwencję „nieznanego pochodzenia”, w której stwierdzono „słabą homologię z rodziną koronawirusów”. Następnie zaprojektowali startery dla tej sekwencji i podczas testowania 44 próbek od pacjentów z SARS tylko 22 były pozytywne. Koronawirus NL63.

Artykuł źródłowy: Lia van der Hock and others. Identification of a new human coronavirus. Nature Medicine, 10, 4 April 2004.

Autorzy stwierdzają, że „identyfikacja nieznanych patogenów za pomocą narzędzi biologii molekularnej jest trudna, ponieważ sekwencja docelowa nie jest znana, więc nie można zaprojektować starterów specyficznych dla PCR”.Użyli narzędzia, które sami opracowali, zwanego VIDISCA, które, jak twierdzą, nie wymaga wcześniejszej znajomości sekwencji! Czy to jest możliwe? Zobaczmy, jak to działa: najpierw przygotowuje się hodowlę i zakłada się, że wirus jest obecny ze względu na dowody na „efekt cytopatyczny”. Nowością wprowadzoną tą metodą jest to, że dodawane są „enzymy restrykcyjne”, enzymy tnące cząsteczki kwasu nukleinowego w określonych miejscach i zawsze o tej samej długości. W ten sposób, jeśli po działaniu tych enzymów zaobserwują wiele fragmentów DNA lub RNA, które są takie same lub bardzo podobne, wywnioskują, że pochodzi on od wirusa, ponieważ genom gospodarza miałby losowe cięcia, podczas gdy genom wirusa przedstawia duża liczba kopii, które są takie same ze względu na replikację wirusa. I czy taka dedukcja jest prawidłowa? Oczywiście, że nie! To założenie (które jest dodane do poprzedniego założenia, że istnieje wirus) nie bierze pod uwagę, że istnieją „cząsteczki wirusopodobne”, „cząsteczki podobne do retrowirusów”, „endogenne retrowirusy”, „egzosomy”, cząsteczki zewnątrzkomórkowe”, a nawet mitochondrialne DNA. Negują istnienie niezliczonych cząstek, które posiadają te same cechy reprodukcyjne w dużych ilościach, co „wirusy” i dlatego mogą fałszować wyniki, wytwarzając dużą liczbę identycznych kopii po przecięciu przez enzymy, jak uznano w artykule na temat techniki VIDISCA zatytułowanym Enhanced bioinformatic proSling of VIDISCA libraries for virus detection and Discovery. Została ona opublikowana w tomie 263 badań nad wirusami w dniu 2 kwietnia 2019 r., a jej autorzy – Cormac M. Kinsella i wsp. – uznają, że „nie oczekuje się żadnej redundancji we wkładce VIDISCA z kwasu nukleinowego tła gospodarza, z wyjątkiem przypadku cech „wirusopodobnych”, tj. dużej liczby kopii jak w mitochondrialnym DNA. Koronawirus HKU1.

Artykuł źródłowy: Patrick C. Y. Woo and others. Characterisation and Complete Genome Sequence of a Novel Coronavirus, Coronavirus HKU1, from Patients with Pneumonia. Journal of Virology, 79, 2, January 2005.

Artykuł, co niewiarygodne, zaczyna się od tych słów: „Pomimo szeroko zakrojonych badań na pacjentach z infekcjami dróg oddechowych, u znacznej części pacjentów nie zidentyfikowano żadnej przyczyny mikrobiologicznej. RNA jest ekstrahowane z nieoczyszczonych kultur”. Zastosowano też PCR z genami koronawirusów. Do sekwencjonowania wykorzystano dwie bazy danych białek zorganizowane w rodziny, domeny i miejsca funkcjonalne – PFAM i INterProScan- w połączeniu z dwoma programami komputerowymi, które przeprowadzają „przewidywania” dotyczące sposobu łączenia nukleotydów. Tekst dodaje: „Sekwencje te zostały ręcznie zmontowane i zmontowane w celu wytworzenia końcowej sekwencji genomu wirusa”. I po raz kolejny nie ma żadnej kontroli.

Koronawirus MERS-CoV.Artykuł źródłowy: Ali Moh Zaki and others. Isolation of a Novel Coronavirus from a Man with Pneumonia in Saudi Arabia. The New England Journal of Medicine, 367:19, November 2012.

Materiał genetyczny jest ekstrahowany bezpośrednio z supernatantu kultury i próbki plwociny za pomocą narzędzia o nazwie High Puré Viral Nucleic Acid Kit, a następnie testowany różnymi metodami PCR pod kątem różnych znanych mikroorganizmów. Nie ma wzmianki o oczyszczaniu i nie ma kontroli.Krótko mówiąc, to, co zostało zrobione w przypadku pierwszych koronawirusów – i wielu innych rzekomych wirusów – polega na wyhodowaniu rzekomo zainfekowanych tkanek – każdy „efekt cytopatyczny” przypisywano tylko obecności wirusa – a następnie albo otrzymuje się pewne białka, które bez żadnego testu są uważane za „antygeny wirusa” i kiedy te „antygeny” są wykrywane w hodowlach, jest to interpretowane jako „izolacja”, albo ekstrahuje się fragmenty kwasów nukleinowych zakładając, że należą one do wirusa.W artykule opublikowanym w poprzednim numerze pisma wyjaśnialiśmy już, że według dr Stefana Lanki tzw. „Efekt cytopatyczny” jest tak naprawdę efektem wywołanym warunkami panującymi w samej kulturze. Zostało to rozpoznane na przykład w artykule Antibiotic-induced release of small extracellular vesicles (exosomes) with surface-associated (Indukowane antybiotykami uwalnianie małych pęcherzyków zewnątrzkomórkowych (egzosomów) z powierzchniowo związanym DNA), opublikowanym 15 sierpnia 2017 r. Na stronie internetowej Nature i podpisanym przez Andrea Németh i innych.(https://www.ncbi.nlm.nih.gov/…/41598_2017_Article_8392.pdf Tu wyjaśniono, że niektóre substancje – takie jak antybiotyki – dodawane do eksperymentów in vitro mogą obciążać kultury komórkowe, generując nowe sekwencje, które nie zostały wcześniej wykryte. Zostało to już zauważone przez dr Barbarę McClintock w 1983 roku podczas jej wykładu noblowskiego, co można zobaczyć na stronie https://www.nobelprize.org/…/06/mcclintock-lecture.pdf.W gruncie rzeczy, ŻADEN Z SIEDMIU przypuszczalnych LUDZKICH KORONAWIRUSÓW NAPRAWDĘ NIE BYŁ IZOLOWANY. Jedyne, co się między nimi różniło, to procedury i techniki laboratoryjne, które stawały się coraz bardziej wyrafinowane, co w tym przypadku oznaczało nie większą dokładność, ale większą zdolność do wprowadzania w błąd i samooszukiwania się, co doprowadziło do wirtualnej produkcji SARS-CoV-2.A oczywistą konsekwencją braku dowodów na jego izolację jest to, że takie „koronawirusy” nie mogą być pociągane do odpowiedzialności za żadną chorobę. Ponadto wszystkie testy – jakiegokolwiek rodzaju – oparte na domniemanych składnikach tych „wirusów” (kwasach nukleinowych lub białkach) są całkowicie dyskwalifikowane jako „testy na zakażenie”, a tym bardziej jako „diagnostyka” chorób.Więcej zapytań bez odpowiedziW poprzednim numerze zebraliśmy już odpowiedzi udzielone przez autorów kilku artykułów, które rzekomo opisywały izolację SARS-CoV-2, w których przyznawali, że nie „oczyszczali”, co w sposób dorozumiany oznacza przyznanie się, że wirus nie został wyizolowany. A teraz dodamy jeszcze jeden dowód: odpowiedzi udzielone przez różne władze – polityczne i zdrowotne – z różnych krajów na temat oczyszczania i izolacji SARS-CoV-2.James McCumiskey – autor książki The Latest Conspiracy: The Biomedical Paradigm- mówi nam, że National Virus Reference Laboratory of Ireland poprosił o informacje na ten temat z Uniwersytetu w Dublinie, a ten ostatni odpowiedział, że „nie ma żadnych zapisów, które mogłyby dostarczyć odpowiedź na ich wniosek”. Dyrektor służb prawnych laboratorium nalegał na skierowanie prośby do uniwersytetu, a uniwersytet odpowiedział, że „nie ma dokumentacji, która mogłaby udzielić odpowiedzi na ich prośbę”: „Uniwersytet stoi na stanowisku, że materiał z debaty akademickiej nie może być przedmiotem ustawy o wolności informacji”. Z wniosku NVR wynika, że nie prowadził on hodowli SARS-CoV-2 ani go nie oczyszczał. Potwierdzają jedynie, że „wykryli RNA SARS-CoV-2 w próbkach diagnostycznych”.W dniu 22 czerwca grupa ekspertów wysłała zapytanie do premiera Wielkiej Brytanii, Borisa Johnsona, o podobnej treści. List podpisali: dr Kevin Corbett, Piers Corbyn – profesor Imperial College London, inżynier i niezależny badacz – z którym przeprowadziliśmy wówczas wywiad w czasopiśmie – David Crowe, dr Andrew Kaufman, edynburski profesor biologii Roger Watson oraz biolog i chemik David Rasnick – i do dziś nie otrzymali odpowiedzi!Inny podobny wniosek – w tym przypadku do National Research Council of Canada – otrzymał następującą odpowiedź: „Nie byliśmy w stanie przeprowadzić pełnego przeszukania rejestrów NRC, więc z przykrością informujemy, że nie zidentyfikowano żadnych rejestrów, które odpowiadałyby na Państwa prośbę”. Dodamy, że dwaj dziennikarze wysyłali podobne prośby – na mocy ustawy o wolności informacji – do różnych instytucji w Kanadzie, Nowej Zelandii, Australii, Niemczech, Wielkiej Brytanii i Stanach Zjednoczonych, a do 5 września odpowiedziało na nie dwanaście instytucji (obecnie jest już ponad 40 odpowiedzi), wszystkie wskazując na to samo: że nie mają żadnych zapisów opisujących izolację wirusa, który ma powodować Covid-19. Szczegóły i odpowiedzi można znaleźć na stronie:https://www.fluoridefreepeel.ca/u-k-dept-of-health-and…

SZUKAMY POCHODZENIA FAŁSZYWEGO GENOMU

Pytanie, które sobie wtedy zadaliśmy, brzmiało: jeśli opublikowane sekwencje nie należą – jak twierdzono – do nowych wirusów, to skąd one pochodzą? Aby spróbować odpowiedzieć na to pytanie, zdecydowaliśmy się na przeprowadzenie wyszukiwania za pomocą programu komputerowego o nazwie Basic Local Alignment Search Tool (BLAST), który pozwala nam na porównanie danej sekwencji ze wszystkimi sekwencjami przechowywanymi w Narodowych Instytutach Zdrowia Stanów Zjednoczonych (jest on publiczny i można go znaleźć na stronie https://blast.ncbi.nlm.nih.gov/Blast.cgi. Wyjaśniamy krok po kroku, co zrobiliśmy, aby nasi czytelnicy mogli powtórzyć wyszukiwanie i sprawdzić jego wyniki.Najpierw zebraliśmy wszystkie startery PCR opisane w ówczesnych protokołach umieszczonych na stronie WHO:- Chiński protokół CDC: wykorzystuje jako cel geny ORF1ab i N.- Protokół Instytutu Pasteura (Francja): używa dwóch fragmentów RdRP (który ma być specyficzny dla SARS.CoV-2).- Protokół CDC Stanów Zjednoczonych: wykorzystuje trzy fragmenty genu N.- Protokół Narodowego Instytutu Chorób Zakaźnych Japonii: jest jedynym, który ma jako cel gen S wraz z innymi genami rzekomo współdzielonymi z innymi koronaawirusami.- Protokół Charite’a (Niemcy): wykorzystuje geny E, N i RdRP.- Hong Kong University Protocol: wykorzystuje geny ORF1b-nsp14 i N.- Protokół Narodowego Instytutu Zdrowia Tajlandii: wykorzystuje gen N. Następnie wprowadziliśmy sekwencję starterów – tę, która wskazuje początek sekwencji do wykrycia (w przód) i tę, która wskazuje koniec sekwencji (w tył) – do BLASTa, aby mógł on szukać ich w dwóch bazach danych: kolekcji genomów mikroorganizmów i tej odpowiadającej ludzkiemu genomowi.

SEKWENCJE TZW. SARS-COV-2 ZNAJDUJĄ SIĘ ZARÓWNO U LUDZI, JAK I W LICZNYCH MIKROORGANIZMACH!

Przyjrzyjmy się szczegółowo procedurze na przykładzie inicjatorów protokołu francuskiego. Na stronie BLAST wybraliśmy Mikroby do przeszukania baz danych genomów drobnoustrojów i przeszliśmy na następną stronę. Następnie pojawił się formularz, w którym wpisaliśmy sekwencję startera forward z francuskiego protokołu – czyli ATGAGCTTAGTCCTGTG-, wybraliśmy opcję Bardzo podobne sekwencje i wcisnęliśmy klawisz BLAST. Zaledwie kilka sekund później pojawiły się wyniki – zrobiliśmy zrzut ekranu (zdjęcie 1) – i pokazano nam 100 sekwencji drobnoustrojów – w szczególności bakterii i archeonów – z koincydencją między 77% a 100% z procentem tożsamości 100%. Następnie wróciliśmy na stronę główną i za drugim razem wybraliśmy Human do przeszukania ludzkiego genomu, powtórzyliśmy tę samą operację i po kilku sekundach pojawił się wynik, który ponownie zarejestrowaliśmy na ekranie (zdjęcie 2). I okazuje się, że wprowadzona sekwencja pokrywa się z 74 sekwencjami ludzkiego genomu, przy czym koincydencja wynosi od 66% do 100%, a procent tożsamości 100%.A to wskazuje, że sekwencja tego początkowego starteru PCR, który ma być specyficzny dla SARS-CoV-2, odpowiada w rzeczywistości 74 fragmentom ludzkiego genomu i stu fragmentom mikrobiologicznym! Następnie zdecydowaliśmy się powtórzyć operację, ale z końcowym lub odwrotnym starterem – czyli CTCCCTTTGTGT – i wyniki były podobne. Ponieważ były to bardzo krótkie sekwencje – około dwudziestu liter genetycznych lub nukleotydów – postanowiliśmy spróbować ponownie, ale z sekwencją docelową zdefiniowaną przez te dwa startery, tj. Sekwencję domniemanego genomu SARS-CoV-2, która znajduje się między początkowym starterem a starterem końcowym. Oczywiście do tego potrzebowaliśmy sekwencji, która jest oficjalnie uważana za „genom SARS-CoV-2” i chociaż tysiące laboratoriów twierdzi, że ją wyizolowało i zsekwencjonowało – fałszywe twierdzenie, jak wyjaśniliśmy w poprzednich raportach – postanowiliśmy wejść na stronę National Center for Biotechnology Information: https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2…. Tam zlokalizowaliśmy „sekwencję docelową”, fragment 108 nukleotydów znajdujący się pomiędzy pozycjami 12 690 i 12 797 „genomu”, czyli tego:ATGAGCTTAGTCCTGTTGCACTACGACAGATGTTGTGCCGGTACACAAACTGCTTGCACTGAT GACAATGCGTTAGCTTACAACAACAAAGGGAG.

Powtórzyliśmy w ten sposób opisane wcześniej kroki i wyniki ponownie były zaskakujące, ponieważ ponownie pojawiło się sto sekwencji mikrobów z procentem dopasowania 100% i cztery sekwencje ludzkiego genomu z procentem tożsamości pomiędzy 83% a 95%. Dopasowania były zatem niższe, ale ważne jest, że nadal znajdujemy fragmenty rzekomej „docelowej sekwencji” SARS-CoV-2 zarówno u mikrobów, jak i w naszym własnym genomie.Naprawdę zdziwieni, zrobiliśmy kolejny krok i przetestowaliśmy z genem uważanym w tamtym czasie za najbardziej specyficzny z SARS-CoV-2, genem E, który ma generować białka otoczki i znajduje się między pozycjami 26.245 a 26.472:ATGTACTCATTCGTTTCGGAAGAGACAGGTACTACGTTAATAGTTAATAGCGTACTTCTCTTGCTTTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTGCTTCGATTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTAAAACCTTTACGTTTACTCGTGTTAAAATCTGAATTCTTCTAGAGTTCGATTCTGGTCTAA. Powtórzyliśmy z nim opisane już kroki, a wynik był tym bardziej zaskakujący, że pomimo jego długości pojawiło się kolejnych sto sekwencji mikrobów z procentem tożsamości 100% i 10 sekwencji ludzkiego genomu z procentem tożsamości pomiędzy 80% a 100%. A podobne wyniki uzyskano z fragmentem wybranym losowo i z genem N, który według nich odpowiada białkom nukleokapsydu SARS-CoV-2.Ostatecznie zdecydowaliśmy się przetestować gen S, o którym mówi się, że generuje strukturalne białka typu „spike”, które są kluczem do wejścia do komórki i który następnie został uznany za najbardziej specyficzny gen SARS-CoV-2. Ponieważ jest to gen, którego sekwencja jest znacznie dłuższa – 3821 nukleotydów między pozycjami 21 563 i 25 384 – przetestowaliśmy dwa fragmenty wybrane losowo w ramach tego genu, a pierwszy – TTGGCAAAATTCAAGACTCACTTTC – zaowocował kolejnymi setkami sekwencji drobnoustrojów i 93 sekwencjami genomu druga – CTTGCTGCTACTAAATGCAGAGTGT – sto sekwencji drobnoustrojów i 90 genomu ludzkiego.Ostatecznie zdecydowaliśmy się przetestować z inicjatorami Protokołu Japońskiego, jedynego, który zawiera sekwencje docelowe genu S i, czytelnik już się domyślił, wyniki były jak wcześniej znowu podobnie: sto sekwencji drobnoustrojów i 93 sekwencje ludzkiego genomu z procentem identyczności między 94,12% a 100%!

WNIOSKI

Konsekwencje wszystkiego, co właśnie wyjaśniliśmy, są jasne i natychmiastowe: NIE MA PRZEKONYWUJĄCEGO TESTU DO WYKRYCIA SARS-COV-2, ani testów przeciwciał ani testów antygenowych, ani RT-PCR. Uwzględniliśmy te oparte na rzekomym genie kodowym dla białka S1 lub kolca. A to oznacza, żeWSZYSTKIE LICZBY „PRZYPADKÓW”, „ZAKAŻONYCH”, „CHORYCH”, „BEZOBROTOWYCH” LUB „UMARŁYCH Z POWODU COVID-19” NIE MA PODSTAWY NAUKOWEJ I WSZYSTKIE „POZYTYWNE” SĄ FAŁSZYWNYMI POZYTYWAMI, o czym należy natychmiast poinformować osoby dotknięte chorobą a osoby odpowiedzialne powinny zostać pociągnięte do odpowiedzialności.Kończymy dodając, że nawet sama WHO tak naprawdę nie wierzy w te testy. Wystarczy przeczytać dokument opublikowany 11 września bieżącego roku jako przewodnik laboratoryjny dla SARS-CoV-2 zatytułowany Diagnostic tests for SARS-CoV-2 – jest dostępny pod adresem https://apps.who.int/iris/rest/bitstreams/1302661/ retrieve – dosłownie stwierdza na stronie 5: „Gdy tylko jest to możliwe, podejrzenie aktywnej infekcji należy zbadać za pomocą testu amplifikacji kwasu nukleinowego (NAAT), takiego jak RT-PCR. Testy NAAT powinny być ukierunkowane na genom SARS-CoV-2, ale ponieważ nie jest znana globalna cyrkulacja SARS-CoV-1, sekwencja Sarbecovirus (przypuszczalnie obejmuje co najmniej pięć ludzkich i zwierzęcych koronawirusów, w tym SARS-CoV-1 i SARS-Cov- 2) jest również rozsądnym celem”. Oznacza to, że WHO zgadza się na użycie sekwencji niespecyficznych do wykrywania SARS-CoV-2.To nie wszystko, ponieważ w podręczniku stwierdza się później: „Optymalna diagnoza składa się z testu NAAT z co najmniej dwoma niezależnymi od genomu celami SARS-CoV-2; jednak w obszarach, w których transmisja jest szeroko rozpowszechniona, można zastosować prosty algorytm pojedynczego celu”.Podręcznik WHO stwierdza: „Jeden lub więcej negatywnych wyników niekoniecznie wyklucza zakażenie SARS-CoV-2. Istnieje wiele czynników, które mogą spowodować negatywny wynik u zakażonej osoby, w tym zła jakość próbki, późne pobranie próbki, niewłaściwa obsługa lub przyczyny techniczne nieodłącznie związane z testem, takie jak mutacja wirusa lub zahamowanie reakcji PCR”.Na co czekają sędziowie, by podjąć działania z własnej inicjatywy?Jezus Garcia BlancaUwaga: autor publicznie dziękuje Juanowi Pedro Aparicio Alcarazowi za jego cierpliwą i skrupulatną współpracę w poszukiwaniu artykułów naukowych oraz za żmudną pracę z BLAST-em.źródła:https://www.dsalud.com/…/la-estafa-se-constata-la-pcr…/https://philosophers-stone.info/…/The-scam-has-been…https://www.fluoridefreepeel.ca/…/FOI-responses-re…————-komentarz profesor Korneli Polok:”Odnośnie SARS-COV2 (innych nie sprawdzałam) nie ma izolatu spełniającego postulaty Kocha. Jest podejrzenie, że faktycznie wirus utworzono wirtualnie, przez połączenie kilku sekwencji. Natomiast trafienia innych organizmów i człowieka nie muszą świadczyć o sztucznej konstrukcji, gdyż np. w genomie człowieka są sekwencje HIV, Ebola, podobne do wirusa grypy. To jest dość normalna cecha wielu organizmów. U SARS podejrzana jest wyjątkowo mała zmienność pomiędzy zidentyfikowanymi sekwencjami w stosunku do innych koronawirusów. Ponadto niektórzy twierdzą (np. Luc Montagner), że są charakterystyczne sekwencje dla konstruktów genetycznych. Warto o tym mówić w kontekście usilnego wciskania szczepionek mRNA, gdyż taka szczepionka nie wymaga aby wirus istniał. Można wymyślać sekwencję i na nią zaprojektować mRNA.”

AlterShot.TV

Przetłumaczyliśmy ulotkę szczepionki kowidowej. Szok!

Tajny program kosmiczny

Protest przeciwko przymusowi szczepień

97034304_2637912613106962_2227967774599151616_o

1:01 / 10:00 PILNE! Dr Rashid A Buttar mówi o nowej rezolucji 6666 wprowadzonej do kongresu amerykańskiego

NIEMIECCY LEKARZE TWIERDZĄ, ŻE COVID 19 TO MIĘDZYNARODOWE PRZESTĘPSTWO

Do czego służą testy eRTe – PeCeR

Cykliczne resety na ziemi to fakt!